METABLE2 Genes

PROKKA_00039 SelectedGram-

GenomeSelectedGram- ctg_1:39076-39402
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00039 hypothetical protein
ATGCTGCTGGCCCTGATGCTCACCTATGCCGGCTTCACCGCGTTGTGCCTGTCGATGCCA
CGCCATCATGCCGAATTGCTCGGCGCCAAACCGTCGACGCGCCGCCGTCAGGGTCTGGCG
TTGGCGGGATGGTTGTTGCTGGCGCTTTCGCTGTGGGCGGCGGTGGCGGCCGGTGGCTGG
AGTTTCGGTCTGGTCGACTGGTTTGCAGTGCTGATGCTCAGCGCTTTGGCATTGGTGCTG
TTGCTGCCGTATCGCCCGCGTCTGGCCATGGCACTGGCCGGGTTGAGCCTGCTGGCGAGC
CCGGTCGCCGCCTGGGCGCAGTGCTGA