METABLE2 Genes

PROKKA_00041 SelectedGram-

GenomeSelectedGram- ctg_1:39967-40956
ProductCDS fec operon regulator FecR
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK09774
Sequence
>PROKKA_00041 fec operon regulator FecR
GTGAAGCCATCAAACCCGATCACGCCGACACCGGCCCAGGAACAGGCCGCGCTGGCCTGG
CTGAGCCTGTTGCACGATCGTCCGAGCACTGCCGATCAACTGACCTTCAGCCAATGGCTG
CGCGCCGATCCGGCCCATGCCGAAGCGTACGCGCAGGCGCAGGTGATCTGGGAACTCAGC
GAAAGCCCCGCGCGCACGCTGGCCGAGGAAGATACGCTTGCGCTGCAAGGTTATCTGCAG
GCGATGGACGCCCCGCGTCGTTCGCCGATGTTGCGTTGGTCTGGAGCGCTGGCGCTGGCC
GCGTGTCTGCTGTTGATGGTCAGCCTCGGCACGGGGTGGCAGGCGCAGCGCTGGCTCGAC
GATCTGCGCGCTGATCATGTCTCGGCACCGGGGGAAATTCGCACGGTGACACTGGCCGAT
CAGTCGCAAGTGACACTGGATGCCGACAGTGCGATTGCTGTGGATTTCAGTCATGGCCAG
CGCCGCGTGAAATTGATCAGAGGTGCTGCTTTCTTCAGCGTCACCCACACCGGCGACCCT
TTTGTGGTGGCGGCGGAGCAGGGCGAAGCGCGGGTGCTCGGCACCCAGTTCGAAGTACGT
CGGCAACCTCACGGCGCACAAGTGACGGTGTTGTCCGGGCGTGTCGCGGTGACGGCAGAC
GAGCATGGCCAACAGCAGATTCTTACGGCCGGTCAGCAAGTTGCCTACGCCGACGGCACT
GCGGAAAAACTGCATGGTGTGGACAGTGAAGCGCAACTGGCCTGGCGTCAGGGTTGGCTG
ACTTACTACAAGACCACGCTGGCCGATGTCGTCGAGGATCTGCGCCGCTATTACCCGGGG
CGGATTGTGCTGCTCAACGATGAGCTGGCGGCGCGCAAGGTCAGCGGCAGTTTCCCGAGC
AAGGATCCGCAAGCGGTGCTCAATTCGCTGCAAGGGGTACTGGGATTTGAGCAGCATCGG
GTGATGGGACAGTTGATCATTCTGCGTTGA