METABLE2 Genes

PROKKA_00045 SelectedGram-

GenomeSelectedGram- ctg_1:45611-46120
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00045 hypothetical protein
GTGAACACCCTGACCACCGACAAACTCATTCGTTTCAGCAAAGTCATCTTGATGGCTTAT
ATAAGTTTCTTTGGCCTGCTGGTGATGATCCATAACTTCACTGACTATGAGTCCAACTAC
ACTTACGTTGCACATATCCTGAGCATGGACACCACCAACGCCAGCGAAAACATCATGTAC
CGCGCGATCGATTCGCCGATGATCCATCACCGGATCTACTGGTTCATCATCACTATGGAA
GTCACCTATACCGTGCTCTGCCTGATCGGTACTTACCAGTTGTATCGCTACATCGATGCC
TCGCCAGCGGCATTTCATGAAGCCAAGAAATTTTCGATCATGGGCATATTGGTTGCCATC
TTCATTTATTACGTGTGTCTGCAAACTGTAGGTGTCGAATGGTTCGACATGGACACTTCG
CAATCCTGGAATGCCAAGGACTGGGCGCGACATATTGTCGACTTCATCTTCCCGGTAATG
ATCTACATCACTTTGAAAGTTGAGCGCTGA