METABLE2 Genes

PROKKA_00047 SelectedGram-

GenomeSelectedGram- ctg_1:48638-49012
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00047 hypothetical protein
ATGTTCAAACCCACACCCAATCCCCCCGAATCCGCAAGCACCTCACCCTACCAATCCCCC
GACTCAACGAAACTCCACGACGCCGCCGAGCGTGCGCTGGATCACTCCCTCAAACCGTCC
GCCAGCGCGCAGCAAAACCACAAACCCAGCACCATGTTCCAGGTCGCCCCGGACCAGGAC
AACGAAAGCCTGCTGGCCCACGCCTGCGAATCCCTCGCCTCGGCCAGCATCATGAGCAGC
GACATCGCCGCCCACGTCGACAGCCCACAACGGCACACCATACTGGCCATCCAGCAGGTG
ATCATGCTGGCGGAACTGGCGGTGAACCGGGTGCTGGATAACTACGAAATCCATCAGCTC
CCGTCACGCAGCTGA