METABLE2 Genes

PROKKA_00051 SelectedGram-

GenomeSelectedGram- ctg_1:54490-54690
ProductCDS efflux system membrane protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK11594
Sequence
>PROKKA_00051 efflux system membrane protein
ATGCCTCGTGAAATCGCCTTCCACGGCGTGTACATGCCGACCATGACCCTGATGTTTTTT
GTCGCTGCGGGGTTGGCCTGGGCGCTGGACCGCTTCCTCTCGGGGTTCGACCTGTACCGT
TTTTTCTGGCACCCGGCGCTGCTGCGCCTGAGCCTGTTTACCTGTCTGTTCGGCGCCATG
GCGCTGACTGTCTACCGTTGA