METABLE2 Genes

PROKKA_00053 SelectedGram-

GenomeSelectedGram- ctg_1:55613-56908
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00053 hypothetical protein
ATGGCAATTGCAAAGAAGGCCGCGAACATCAGGGCGACAATCGACGCCACATGGGGAAGC
GGCCAAGGCAAACTTCAACTTGACGATATATTCCAAGACGACCCGACGAAGTCCCGGCCC
CTCACGGGGTCGACGCTGCTGCGCGATAAATCGTTGCTGGTCACCAGTACCTTCGACAAC
GGCGTCTTCTTCATTTCCAAGCTGAACCACTTGGGTGCCGTAGACCTGGCGTTTGGGGCC
GCAGGGCGTGTCACGGGTTCGTTCCTGGCCAATGAGCAAGCCTCTGGCGGGCCGATTGCA
GAAGGTGCCGACGGGCGGCTGTTCATGGCAGGCAGCACAGCCAATGAGCAATCGAACGAG
GTTAGCGCTGCGATTCTCTGCCTTGACAGCAAAGGCAATCGAGTGAGCAGCTTTGGCGAG
AATGGCCAAGTCATCATCGATCCCCCAAACACACAACGGCTTACGAAAAAAGGCCCGGCA
TTCGTCTTCGCGCTACCCGATGGCAGCGTTATTGTCGGCGTTGATTACCACACGCCTGAC
GTGCTCAAGGCGCACCTTTACAAATTCGATGCGCAAGGCGCACCCGTGAAGGCATTCGGC
ACAGATGGCCGAGTTGAAATTAATCACGGGATGCCGCATGCATCGACTTCACTCAGCGAC
GGTTGCGTGCTCGACAATGGACTCTTGTTATTTGCAGGCTACGAAAAATACGAGCCGGAC
GTGAACACGGACGGTCTCCTCGTGATGTTGAATTCAGACAGTGGCGCGCCCCATGAGAAT
TTCGGCCTCCCGGAAAGACCCGGGGTTGTGGTAGTCCGGTACAACTCCATGGGTGCCGAA
CTCAATACTGTGAGACAGCGAGCCCCTGATAGATTTACGGCATCTGGCTACACCAACATG
GGCAGCGGTGTCAGTGAGCGATACGGCATGTTGTTCGCCTTCGATGAAAAAGGTAAGCCC
GATTTTGACGTTTTCGGCAGTCCGAATGCCATGCCACTCCCACCAGCTCTCGGCAGCGAC
AGGCGAGTCAACTGGGCGGACCATGTTCCTTTCGCTGATAACATCGTAGTTTCTGGTGGA
GACGAGAAGGGCAATTATATTGCCTGTGTGAAAACCCGGAGCGGCGGCTACAACTCCGAT
TTTTCAGACGCGGGTGGCGTCATCCATCGCGACGAGACCACCGACTCGCTCTCCAGGCTT
CATTATCAGCAGGCCCCAGGCAAATTGATTGTTGCCCTCAACATCAATCCAGAAAACCCT
CTGGGTTGTCTGTATCGCTACAACATTTCCCAGTAG