METABLE2 Genes

PROKKA_00054 SelectedGram-

GenomeSelectedGram- ctg_1:57070-57894
ProductCDS putative oxidoreductase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q99RF5
Sequence
>PROKKA_00054 putative oxidoreductase
ATGCCCGTTGCGTTGATTACCGGTTGTTCCAGCGGCATCGGCCGCGCCCTTGCCGACGCG
TTCAAAGCCGCCGGCTACGAAGTCTGGGCCAGTGCGCGCAAGGCTGAAGATGTCAGCGCG
CTGAGCGCTGCCGGTTTCACCGCTGTCGAGCTGGACGTCAACGATGGCGCCGCGCTGGAA
CAACTCGCCGAGCGTCTGAGCCAGCAACATGGCGGCCTTGATGTACTGATCAACAACGCC
GGTTACGGCGCGATGGGGCCGCTGCTCGACGGCGGCGTGCAGGCGATGCAGCGCCAGTTC
GAGACCAACGTGTTTTCGATTGTTGGCGTCACCCGCGCGTTGTTTCCGCTGCTGCGTCCG
GCCAAGGGGTTGGTGGTGAATATCGGCAGTGTGTCGGGTGTGCTGGTCACACCGTTTGCC
GGCGCCTACTGCGCGTCGAAAGCGGCGGTGCATGCGCTTAGCGACGCGTTGCGCATGGAG
CTGGCACCGTTTGGCATCCGTGTGATGGAAGTCCAGCCTGGTGCGATTGAATCGAGTTTT
GCGAAGAATGCCGGACATGAAGCCGAGCAGTTGATCAACGAGCAATCGCCGTGGTTTCCC
CTGCGTGAAGGCATTCGGGCACGGGCCAAGGCATCGCAGGACAAGCCAACGCCGGCCAGT
GAGTTTGCGGCTGAGCTGTTGAAAGCGGTGCGGCAGAGCAAGCCGCCACGGCTGGTTCGC
ATCGGCAACGGCAGCCGGGCGTTGCCGTTATTGGCGGCGTTGTTGCCGCAAGGGTTACTC
GAATCGACGTTGATGAAGCGGTTCGGGTTGCGCGCCAGGCTCTGA