METABLE2 Genes

PROKKA_00055 SelectedGram-

GenomeSelectedGram- ctg_1:57930-58394
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00055 hypothetical protein
ATGTTCATCGGCATCCTGCTGGTCATTACCTGGTTGATCCTGCTGCTGCGCTACCCGGCC
AAGGCCTTGCCGGTTTCGGTATCCGCTGCGATTGGCTTGGGTTTCGTGGCCATGTGGGTG
GTGTGGCTGGACAACCGCGAGATCAAGCAACTGGCGCGCCTGGAACTGCGCATTGCCTAC
GCTCCCGAGCAATGCCCGGCCGACCGTCCGCTGCAATTGAAAATGAACAATGGCAACAAT
GTGCCGCTGACCGAGCTGCGCTGGCGCATCGCCGCTTATGCGCCGGGCGATACGGTCAAC
CTGGCCGACAATCAATACACTGCCCCACGCTATCGTGGCCCCGGCGAGTTGCAGGCCGGT
GCAACCTGGGAAGACTGCTTGCCACTGCCGCCGCTGCGCCCCGGCTATCGTCCGCAAACC
CTGGAGTTTCGCGCCGAGCATTTGCAAGGTAGTTTCTCCGACTGA