METABLE2 Genes

PROKKA_00058 SelectedGram-

GenomeSelectedGram- ctg_1:63049-63705
ProductCDS Alginate O-acetyl transferase AlgF
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF11182.2
Sequence
>PROKKA_00058 Alginate O-acetyl transferase AlgF
ATGACTTTCACTACTACTCCTCGTCGTCTCGCTAAAAGCTTCGCACTGGTTGCTGGCCTC
AGCGTACTTTCCGTCCCAGCCTTCGCCGGTGGCGACGCCGCGCTGTACGGCCCGACCGCT
CCGAAAGGCTCGAGCTTCGTGCGTGTCTACAACGCCAGCAACGCCGAAGTCAGCGCGACT
GTCGGCAGCACCAACCTGAGCGATATCGCGCCACTGGCCAGCAGCGACTTCAGCTTCATG
CCGGGCGGCGATTACAGCGCCAAGGTCGGTAGCCAGACCCTGCCGGTGAAACTCGCCGGT
GACCACTACTACACCCTGGTCAACAACGCTTCCGGCGCGCCACAACTGATCGAAGAGCCG
CCATTCAAGAACAAGCAGAAATCCCTGGTGCGTGTACAGAACCTCAGCGACAAATCGCTG
ACCCTGAAAACCGCCGACGGCAAGACCGAAGTGGTGCCGAACGTGGCAGCCAAGGGCCGT
GGCGAACGTGAAATCAACCCGGTGAAAGTCAGCCTGGCACTGTACGAAGGCGACAAGAAA
GTCGGCGACGTGAAACCGGTCGCCCTGGAGCGCGGTGAGGCAGCGGTGCTGTACGTCACC
GGCAACGGCAGCAACCTGTCGCCAGTCTGGGTGAAACGCCCGGTGTCGACTCGCTAA