METABLE2 Genes

PROKKA_00065 SelectedGram-

GenomeSelectedGram- ctg_1:72345-73847
ProductCDS Sel1 repeat protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF08238.6
Sequence
>PROKKA_00065 Sel1 repeat protein
GTGACTACGCATAACTTGAACACACCGCCGACCCTGTGGGAGCGAGCCTGCTCGCGAAAG
GGCCAGCGCGGTTTGTCTGAAGTACCGAGTCGACTGCTTCGCGAGCAGGCTCGCTCCCAC
ATGGGATTGATGGTGTGCTCGCTGGCACTGGCAGTTTCTATGGCCGGTTGCGCCGGGCTG
CCCGATCAGCGTCTGGCCAACGAAGCGCTCAAGCGTGGCGACACCGCCACCGCTGCGCAG
AATTACCAGCAACTGGCCGATCTGGGTTACAGCGAGGCGCAAGTCGGCCTGGCCGATATC
CAGGTCGACAGCCGCGACCCGGCGCAGATGAAACAGGCCGAGGCGACTTACCGCGCAGCG
GCCAGCGTGTCGCCGCGTGCCCAGGCACGTCTCGGTCGTTTGCTGGTGGCCAAGCCGGGC
TCCACCGAAGCCGAGCACCACGAAGCCGAAACCCTGCTGAAAAAAGCCGCCGCCAATGGC
GAAGGCAACACGTTGATCCCGCTGGCGATGCTATACCTGCAATACCCGCACAGCTTCCCC
AACATCAACGCGCAGCAGCAGATCGATCAGTGGCGCAAGTCGGGCTACCCGGAAGCGGGT
CTGGCGCAGGTGCTGCTGTATCGCACCCAGGGCACTTACGACCAGCATCTGGATGACGTG
GAAAAGATCTGCAAGGCCGCGCTCAACACCACCGACATCTGCTACGTCGAACTGGCCACC
GTTTACCAGAAACGCGGCCAGCCGGAGCAACAGGCCGAGCTGATCAAGCAGATGCAGGCC
GGTTACAGCCGTGGCACCGTCACCGCGCAGCGTGTCGACTCCGTAGCCCGCGTGCTGGCC
GATTCGACCCTGGGCAAGACTGACGAAAAAACCGCGCAGGCGCTGCTCGAGCCGATCGCT
CCGGGCTACCCGGCATCGTGGGTCACCCTCGCCCAACTGCTTTACGACTTCCCCGAACTG
GGCGACGTCGACCAGATGATGAAGTACCTGGACAACGGTCGCGCTGCCGACCAGCCGCGC
GCCGAACTGCTGCTGGGCAAGGTCTACTACGAAGGCAAAATGGTCCCGGCCGACGCGAAA
GTCGCCGAGGAACACTTCCAGAAAGCCGTTGGCCGCGAAGTGGCCGCCGATTACTACCTC
GGCCAGATCTACCGTCGAGGCTACTTGGGCAAGGTCTATCCGCAGAAGGCTCTGGACCAC
CTGCTGACCGCTGCGCGCAACGGCCAGAACAGTGCCGACTTCGCCATCGCCCAGTTGTTT
TCCCAAGGCAAGGGCACCAAGCCCGACCCGCTGAACGCTTACGTGTTCAGCCAACTGGCC
AAGGCCCAGAACACCCCGCAAGCCGATGAACTGGCAGCGACCCTCGAGGCGCAATTGCCG
CCCGAGCGCTTGCCCGAAGCCCGCCGCCTGTTGCAACAGGAACAGGCCAGCCGTGGCGCC
CTGAACTCGAACACGCTGCAACTGCACGCCCTGCAAGAAGAAGACGGCGAGGAAAAACTA
TGA