METABLE2 Genes

PROKKA_00066 SelectedGram-

GenomeSelectedGram- ctg_1:73863-75032
ProductCDS Alginate biosynthesis protein Alg44
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q9HY69
Sequence
>PROKKA_00066 Alginate biosynthesis protein Alg44
ATGAATACCGCCGTCAACGTCAACGTAGTGCATGAATCCGAAGCCCAGCGCCAGCACGCT
CGCGTGAAAATCCCGGCCAAGCTGCGTTTCTTCGGCCCTGACCGGACTCCGCTCGAAGCG
CGGGTCCTCGATCTGTCGGCTGGCGGTCTGGCGTTCAACGCCGGGCAGATGCCACTGACC
ATCGGCGAGGTGTACAAGGCGCGTCTGCAATTTGTCATCGACAACCTCGGCCTGGCCATG
GACGTTGAACTGCAGGTGCGTTCCTTTGACCGCGCCACCGGCCGCGCCGGCTGCCAGTTC
CAGAACCTCGAGCCGCAGGACATTTCCACCCTGCGCCACCTGATCACTTCGCACCTGGCC
GGCGACATCGTCAGCATCGGCGAAGTGCTGGCAACCCTGCAGCGCGACAATTTCACCAAG
GCGCGCAAGAACAAGACCAACGACACCGGCATGACCCCGTTCGGCCGCCTGAAAGCCGTG
ACCTTCAGCGCCGGTATTTTCGCTGTTGGTCTGGTCGCCGCCGGTTTCATCTTCAAGTCG
GTGTACGGCATGTACTTCGTCAGCCACGCCCAGGCCGGTCTGGTCAGCGTGCCGGGGATG
AACATCACCATGCCGCGTGACGGCACCGTACAGAGCCTGGTCAAGTCCGACGGCGTTGCC
GCCAAAGGCGCACCGCTGGCGACCTTCAGCACCAGCATGCTCGACGTGCTCAAGGGCCAT
CTGGCCGAAGACCAACTGGCCCCGGCCAAGGTTGAAGAACTGTTCGGCAAGCAAATGACC
GGCACCCTGACTTCGCCGTGCGACTGCACCGTGGCCCAGCAACTGGTGGCTGACGGGCAG
TACGCGAGCAAGGGCGACGTGATCTTCCAGTTGGTGCCGCGCAACACCCAGGCCAACGTT
GAAGCACGCTTCTCCTATCGCCAGTTCGGCGACGTGCGCCCGGGCACCCCGGTGAGCTTC
CAGATCGCCGGCGAAGACAAGACCCGCACCGGCAAGATCGTCAGCAGCACGAGCCTGAAG
AGCGCCGACCTGTCCTCCGACATCCGCGTGCAGATCCAGCCTGACGAGCCGCTCGACAGC
AGCCTGGCCGGCCGCCCGGTTGAAGTGAACAGCGACCGTGGCCCGAACCTGAACTGGCTG
ATCGACAAAGCCATGGCTGCCGGTCTTTAA