METABLE2 Genes

PROKKA_00067 SelectedGram-

GenomeSelectedGram- ctg_1:75068-76558
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00067 hypothetical protein
ATGCAGATTATGCACAGGCTAAAACACGGCCTACTTCAGGCCGCCGGTTGGCTGTTTTAC
CTAAGTTTGTTGATGGGCCTGGCCTTGATGCTGCCCACGTCCACATTCGACTCCGAGTCG
AAGGACTTCATTTTCCTGATTGGCGCCGTGGGTATCTGGCGCTACTCGATGGGTGCAACG
CACTTTGTGCGCGGCATGATTTTTCTCTACATCGTTTACCCGCACCTGCGTCGCAAAGTA
CGCAAGCTGGGTAAAGCGGCCGATCCGTCGCATGTGTTTCTGATGGTCACCAGCTTTCGT
ATTGACGCGCTGACAACCGCGCAGGTCTACAGCTCGGTGATCCGCGAAGCCATCGACTGC
GAACTGCCGACCACCATTGTCTGCTCGATCGTGGAAATGTCCGACGAGCTGCTGGTCAAG
GCGCTGTGGGCACGGATGAATCCGCCGGAGCGGGTCAAGCTCGACTTCGTGCGCATTCCC
GGCACCGGCAAGCGCGATGGTCTGGCCTTCGGTTTCCGTGCGATCTCCCGTCACCTGCCG
GACGACCGTGCCGTGGTGGCCGTGATCGACGGCGACACCGTGCTCGGCGAAGGCGTCGTG
CGCAAGACCGTGCCGTGGTTCCAGTTGTTCGGCAATGTCGGCGGCCTGACCACCAACGAG
TTCTGCGAAGTGCGCGGCGGCTACATCATGAGCGAATGGCACAAGCTGCGTTTCGCCCAG
CGCCACATCAACATGTGCTCGATGGCCCTGTCCAAGCGCGTACTGACCATGACCGGTCGG
ATGTCGGTGTTCAAAGCCTCCGTGGTGACCAATCCGGAGTTCATCGCCGACGTTGAAAGC
GACTCGCTGCAACACTGGCGTCTGGGCCGCTTCAAGTTCCTGACCGGCGACGACAAGTCG
AGCTGGTTCAGCCTGATGCGCCTGGGTTACGACACCTTCTACGTGCCGGATGCCGCGATC
AACACCGTTGAACATCCGCCGGAAAAGAGCTTCATCAAGGCCAGCCGCAAGCTGATGTTC
CGCTGGTACGGCAACAACCTGCGCCAGAACTCGCGTGCACTGGGCCTGGGTATCCGCCGC
CTCGGCGCGTTCACCTCGGTGGTGCTGTTCGACCAGCGCGTGTCGATGTGGACCTCGCTG
CTCGGCCTGACCGTCGCACTGATCGCCAGCTTCAAGTACGGCACCGCGTTCATCCTCGTG
TACCTGCTGTGGATCGGTATCACCCGCCTGATCCTGACGCTGTTGCTGTCGTGTTCCGGT
CACCGCATCGGCCCTGCTTACCCGGCGATTCTGTATTACAACCAGATCGTTGGCGCCCTG
GTGAAGATCTACGTGTTCTTCCGCCTCGACCAACAATCCTGGACTCGCCAGCCCACATCC
CTGACCCGTGATCTCGCCAGCTTTCAACGTTGGTTCAACACCTGGTCGTCTCGGACCATG
ACCTTCTCCGCCGGCAGCATTTTTGTCGCCGTGCTGCTGATGATGGTCTGA