METABLE2 Genes

PROKKA_00069 SelectedGram-

GenomeSelectedGram- ctg_1:78931-79710
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK02101
Sequence
>PROKKA_00069 hypothetical protein
ATGCTGATGGTGATTTCCCCCGCCAAGACCCTCGACTACGAAACACCGCCGGCGACCCAG
CGCTTCACCCAGCCGCAGTACCTCGACCATTCCCAGGAACTGATCCAGCAATTGCGCGAG
CTGAGTCCGGCGCAGATCAGCGAGTTGATGCACGTGTCCGACAAGATCGGTGGCCTCAAC
GCCGCGCGTTTCGGCAGTTGGACACCCGCCTTCACCCCGGAAAACGCCAAGCAGGCCCTG
CTCGCCTTCAAGGGTGACGTGTACACCGGCCTGGATGCGCAGTCCTTCAGCGAAGCGCAA
TTCGATTACGCGCAAAAGCACTTGCGCATGCTCTCCGGCCTTTATGGCCTGCTGCGCCCG
CTGGACCTGATGCAACCCTATCGCTTGGAAATGGGCACCAAACTGGCCAACGGCCGTGGC
AAGGATCTGTATGCGTTCTGGGGTACGCGCATCAGCGAGTGGCTGAATGAAGCGCTGGCC
GATCAGGGCGATGACGTACTGCTCAACCTTGCATCCAACGAATACTTTTCTGCGGTCAAG
CGCAGCGCGTTGAAGGCGCGGATCATCAGTACCGAGTTCAAGGATCAGAAGAACGGCCAG
TACAAGATCATCAGTTTCTACGCGAAGAAAGCGCGCGGCCTGATGAGCCGTTTTGTGATC
CAGGAACGCATCAACGACCCGGCTCAGCTCAAGCAATTCGATGTGCAGGGTTATCGCTAC
AGCGCCGAACAATCGAAACCTGACAATCTGGTGTTTTTGCGCGACCACGCCCCGGAATAA