METABLE2 Genes

PROKKA_00070 SelectedGram-

GenomeSelectedGram- ctg_1:80026-81150
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00070 hypothetical protein
TTGCGCATTGTTCTTTTATTCACCGCGTGGCTGCTGAGCTTCGGCGCCATGGCGGCGCCC
GGTGATGCGGCGACGCTGGATCGCACGACCTGGCCGGAGCAGCTCAGCAATCCGACCCTG
TTCGACGTCGCGTCGCGGGCGGAAATCCTCATGTTCGCTCGTGGCCTGCTCGGCACCGAG
TCCATCGACGAGGCGGCACTGGCCCAGCGCCTGGGCCTGCGCACGGTCAATATCGATGCG
GTCAATCAGCTGCGCCAGCGCCTCTGGCAGCGCTTGCTCGCCAACTACAACCACGCCCAG
CAAAGCTGCGATCAGGACGCCTCGTTCTGCTTCCTCGTTGAGGACCTGCCGACCCTGCGC
GAGCAGGCGGCCAAGTTCGTCGTCAGCGACGACAGCTATTACACCAAGTGGGCCGAGCCG
AGCCGGATCTTCCATTTGCAGTACCTCGACGAGCTGATGCGCAAGGCCGCGCTGTCGCCA
CAAACCAGTAGCGAATTCGATCGTTTCGGCGACTACGAGCGCAACGGCGACGACATGCAC
GACCGGCTGTTTCTGCTGACGTTCGACAGCGCCGCCAACGTGCAACCGGACAACACCGAC
TGGCTGACCGAATACCTGCGCAAGTCCAATCTGAGCGGGACATTCTTTGTCTTGGGCAAG
GATATTCAGGCGCGACTCACCGGCAGCTCGGTCAGCAGCCTGCAGGCGAGTTTCTCCCGG
CAGTGCGTTGGCGTGCAGGGCTGGGAGTTCCGCTCCCACAGCCATTGGCAGGACTGGCAG
GATTCGGTGCGGCGCAGCGCCGATCTGGTGAAGAACAAACTGCCGGAAAACTACGTGCCG
CTGTTCCGTCCGCCGGATGGCCAGCGCCGCAGTGACGCACAAGGTTTCTTCAATAGTCAG
GGCCTGCAAGTGGCGCTGTGGGACATCGATGCCCAGGACGGTGCCGGCAAACTCAAAGGC
CCGGCGAGCGCGCAGCGGGTGCTGACCCTGATGCTGCTGTGGCGCCACGGGGTGATCAAT
TTCAACATTAAACAGGATGCGGTGAAGACGTCCCTGCCGTGGCTGATCACCCAGACTGCG
CAGAGCGGCATCGGCTGGGAAGACTGTCAGGACGCGTTTCGTTGA