METABLE2 Genes

PROKKA_00076 SelectedGram-

GenomeSelectedGram- ctg_1:85412-86038
ProductCDS YheO-like PAS domain protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF08348.5
Sequence
>PROKKA_00076 YheO-like PAS domain protein
ATGACTGCCCCTGAATTCGACCCGGCGCTGGATAACTTCCGCGCCATCGCCGACGCCATC
GCCACGCTGTTCTTTCCACATGCCGAGGTGGTGCTGCACGACCTGCGCACGCAGAAGGTC
GACTACATCGCCAACAACCTGTCCAAGCGCGAGATCGGCGACGACTCGTCACTGGAAGAC
ATGCTCAGCGAGGATGTCAGCGACAGGAACATCGGCCCGTACGAAAAGCTCAACTGGGAC
GGTCAGAAAATTCGCAGCCTGAGCACCGTGCTGCGTGACAGCGAAAGTCGGCCGCTGGCG
GTGCTGTGCATCAATCTGAATATTTCCCTGTTCGAGAACGCCAAAGCGGCGCTGGACCTG
TTTCTCTCGCCGAGCAAACTGATTCCGCAGCCGGACTCACTGTTCCGTGATGACTGGCAG
GAACGCATCAACACCTTCCTCCACGCCTGGTTGCGCGAGCGGCAGTTGAGCCTGAACCTG
CTGACCCGCGATCACAAACGCGAACTGGTGCTGGCGCTGCACGCCGAGGGCGCGTTCAAG
GGCAAGAGCGCCTCGAACTACGTGGCCAATGTGCTGAACATGGGCCGGGCGACGGTGTAC
AAACATTTGAAGGAATTGAAGGGCTGA