METABLE2 Genes

PROKKA_00078 SelectedGram-

GenomeSelectedGram- ctg_1:87390-88334
ProductCDS ornithine cyclodeaminase
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK06141
Sequence
>PROKKA_00078 ornithine cyclodeaminase
ATGTCCAGTACGCCCTATGTGATCGATCAGGCCCAGGCCCATGAGCTATTGGCGCGTATC
GATGTTCCGCAAATCCTGCGCAAGCTGTTCCGCGATCTGGCGGCCGGGAACGCCGTGCAG
CCGGCGCAGCAATGGGTCGAGTTTCCGCAGGGTGCCGGCGACTTCATCAATTATCTGGGC
GTGCTGGCCGAGGACGGCGTGTACGGAGTGAAGACTTCGCCGTACATCGTCCGTGAGCAG
GGTGCGCTGGTGACGGCGTGGACCCTGCTGATGTCGACGAAAACCGGTCAGCCGCTGCTG
CTCTGTGATGCCGGCGAACTGACCACCGCGCGCACCGCCGCGACCACGGCCGTGGCGGTC
GACGCCCTCGCCCCGTTGAATGCCCAGCGACTGGCGATCATCGGCAGCGGCAAGGTTGCT
CAAGCGCATCTGCATTACGCCAAAGCGCTGCGCGACTGGCAGAGCATCAGCCTGTATTCG
CCATCGCTGCTGGAAGATGCGCAAACACAGGCTGTGTTGAAGTCCATCGCGCCGTCACTG
AAGATTGCCGACAGCCGCGAGACCGCCATTGCCGATGCGGATGTGATCATGCTCTGCACC
TCGTCGGCCGGGCCGGTAATCGATCCTGCCGGGTTAAGCAAACCGGCGCTGATCACCTCG
ATCAGCACCAACGCCCCGCGCGCCCATGAAGTACCGCCGCAAAGCCTCAACGACATGCAG
GTGTTCTGCGACTATCGTCTGACCACGCCGGGTTCGGCAGGTGAGATGCTGATTGCCGCC
GAACAGCATGGCTGGAACAAGGATTCGATTGTCGGCGACCTCGCCGACTTGCTCAGCGAA
AAAGTGCAGCGCCCGGGTTACGACCGTCACGTGTTCTTCCGTTCAATCGGCTTGGGCCTG
GAAGACATTGCCCTCGCCAATGCGGTTTATCACCTTCGCCGCTGA