METABLE2 Genes

PROKKA_00086 SelectedGram-

GenomeSelectedGram- ctg_1:95852-96019
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00086 hypothetical protein
ATGCTGCAGCGCAACATGCTGTACAAATCGATGAAGACCTATGACAACCACCGTATCTGG
CAGGACGTCTATCACATCAATTCACATGGTATGGAGATTTACATAAAGGTGTCATATCAC
AGTGACAGACGCCCGCCCGTGATCTCCTTCAAGGAGAACAAATCATGA