METABLE2 Genes

PROKKA_00089 SelectedGram-

GenomeSelectedGram- ctg_1:98474-98944
ProductCDS SnoaL-like domain protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF12680.1
Sequence
>PROKKA_00089 SnoaL-like domain protein
TTGAGCGAAGCCCATAGCGCCCTGATCACCCGCTTCTACCAAGCCTTTCAGCGCCTTGAC
GCAGAAGCCATGGCCGCCTGCTACACCGATGATGTGGTCTTCAGCGATCCGGCCTTCGGC
GAGTTGCGCGGGCGCGATGCCGGCGACATGTGGCGCATGCTGACTACCCGCGCCAAGGAT
TTTTCCCTGACTTTTGACAATGTCCGCGCCGATGAGCGCACCGGCGGCGCGCATTGGGTG
GCGACTTACCTGTTCAGTCAGACCGGCAACGTCGTGGTCAACGACATCCAGGCGCGCTTC
GTCTTCCGGGACGGCAAGATCTGTGAGCACCACGACCACTTCGATCTGTGGCGCTGGTCG
CGGCAGGCGCTCGGTTTCAAAGGCCTGCTGCTGGGCTGGACGCCGCTGGTGCGCAACGCG
GTACGTGCCCAGGCGCGCAAGGGACTGAAGGCATTTCAGGCCGGGCGCTGA