METABLE2 Genes

PROKKA_00090 SelectedGram-

GenomeSelectedGram- ctg_1:98985-99287
ProductCDS GIY-YIG nuclease superfamily protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK00329
Sequence
>PROKKA_00090 GIY-YIG nuclease superfamily protein
GTGACCAGCCTTAGCGAACAATCCGTCGATGCTGCCGAGCCAGTGAGCAAATCCTGGTTC
GTCTACCTCGTGCGTGCCGCTAATGGCTCGTTGTATTGCGGAATCAGCGACGACCCTGTG
CGGCGTTTCGCCAAGCACCAGAGCGGCAAGGGCGCGCGGTTCTTTCTTTCCAGCCCGGCG
ATGGCCCTGGTCTACACCGAACTGTGCCGCGACAAAAGCGATGCCCTGCGACAGGAACGG
CTGATCAAGAAACTCAAGAAGAGCGCCAAGGAATGCCTGGTCGCGTCTTATCAATCTGAC
TGA